Phage-resistant Streptomyces abietis and its telomycin bioactive metabolite as a possible alternative to antibiotics

doi:10.1016/j.micpath.2024.106822

Microbial Pathogenesis

Volume 194, September 2024, 106822

https://doi.org/10.1016/j.micpath.2024.106822 Get rights and content

Highlights

•
Streptomyces abietis strain was resistant to ϕPRSC1, ϕPRSC2 and ϕPRSC4 isolated phages.
•
Telomycin was an antibacterial metabolite extracted from phage-resistant S. abietis.
•
Telomycin was potent against L. monocytogenes, MRSA-VISA and M. luteus.

Abstract

Multidrug-resistant pathogens are now thought to be the primary global causes of disease and death. Therefore, it is imperative to develop new effective bioactive compounds from microbial sources, such as Streptomyces species. Nevertheless, the pharmaceutical industry suffered financial losses and low-quality end products as a result of Streptomyces bacteriophage contamination. To reduce the likelihood of phage-induced issues in the medical industry, it is crucial to develop a method for finding phage-resistant strains. Hence, we aimed to isolate and characterize Streptomyces spp. and Streptomyces phages from various rhizospheric soil samples in Egypt and to investigate their antibacterial activities. Moreover, we targeted development of a Streptomyces phage-resistant strain to extract its active metabolites and further testing its antibacterial activity. Herein, the antibacterial activities of the isolated 58 Streptomyces isolates showed that 10 (17.2 %) Streptomyces isolates had antibacterial activities against the tested bacteria including Listeria monocytogenes, E. coli O157, Acinetobacter baumannii, methicillin resistant-vancomycin-intermediate Staphylococcus aureus (MRSA-VISA) and Micrococcus luteus. Three lytic bacteriophages (ϕPRSC1, ϕPRSC2, and ϕPRSC4) belonging to the families Siphoviridae and Podoviridae were obtained from the rhizospheric soil samples using the most potent S. abietis isolate as the host strain. The three isolated Streptomyces phages were thermostable, ultraviolet stable, infectious, and had a wide range of hosts against the 10 tested Streptomyces isolates with antibacterial activities. The DNA of the ϕPRSC1 and ϕPRSC4 phages were resistant to digestion by EcoRI and HindIII, but the DNA of ϕPRSC2 was resistant to digestion by EcoRI and sensitive to digestion by HindIII. Of note, we developed a S. abietis strain resistant to the three isolated phages and its antibacterial activities were twice that of the wild strain. Finally, telomycin was recognized as an antibacterial metabolite extracted from phage-resistant S. abietis strain, which was potent against the tested Gram-positive bacteria including L. monocytogenes, MRSA-VISA, and M. luteus. Thus, our findings open new horizons for researching substitute antimicrobial medications for both existing and reemerging illnesses.

Keywords

Streptomyces species

Phage

Streptomyces abietis

Telomycin

Phage resistant

Streptomyces

1. Introduction

The antimicrobial resistance (AMR) phenomenon among bacterial pathogens is a noteworthy public health concern adversely affecting clinical and therapeutic outcomes [[1], [2], [3]]. It is on the rise all over the world as infections are triggered by multidrug-resistant (MDR) bacterial pathogens, which are considered the leading causes of illness and mortality [[4], [5], [6], [7]]. Recent advances in the field of medical science have led to the discovery of potent innovative therapeutic drugs from microbial sources. Among microbes, members of the class actinobacteria, especially Streptomyces species (spp.) are of enormous importance as they have long been documented as biocontrol agents against bacterial infections. Streptomyces spp. are filamentous Gram-positive bacteria localized in the soil and they have a crucial part in the medical industry with one such species producing more than two-thirds of naturally arising antibiotics used clinically [8]. Streptomyces are prolific sources of bioactive compounds with antibacterial, antifungal, and anticancer activities [9], and they have been studied widely for treating various human infections [10]. Telomycin was selected from the culture broth of Streptomyces spp. as a promising bioactive agent with various notable effects [11,12]. Telomycin precursors and numerous semi-synthetic lipopeptide derivatives displayed high bactericidal properties and they were effective mainly against Gram-positive MDR pathogens [13]. Thus, it is urgently needed to discover novel therapeutic agents, and screen for innovative Streptomyces from unexplored sources to combat the AMR phenomenon.

Recurring issues of bacteriophage contamination and cell lysis have been recorded with some actinomycetes used in the pharmaceutical industries resulting in low-quality end-products, fermentation failure, and subsequently substantial economic losses. Isolation of Streptomyces phages mainly from moderate soil samples is recognized as a simple technique used to control this phage contamination issue [11]. Phages that attack Streptomyces are prevalent and multivalent Streptomyces phages appeared able to lyse the parent colony and other species. Interestingly, outbreaks of Streptomyces phages were reported in the streptomycin commercial production resulting in lower yields of streptomycin [14,15]. Therefore, employing an array of approaches to discover phage-resistant strains is vital to diminish the risks of phage-induced problems in different industries. Previous studies stated that the development of phage-resistant S. mediterranei strains was found to eliminate the virulence phage and significantly increase rifamycin bioactive metabolite yields [16,17].

Relatively little has been published on Streptomyces phages and Streptomyces phage-resistant strains. Thus, the current study aimed to isolate and characterize Streptomyces spp. from various rhizospheric soil samples in Egypt, and investigate its antibacterial activity, in addition to, isolation and characterization of Streptomyces phages from rhizospheric soil samples. Finally, we attempt to develop a Streptomyces phage-resistant strain to extract its active metabolites and test its antibacterial activity.

2. Materials and methods

2.1. Sample collection

Seven soil samples from rhizosphere zones around the roots of cultivated plants including rice, wheat, and flowers were collected at 10 cm depth from the top soil from seven different localities in Egypt and stored in sterile plastic bags; some of the collected samples were kept for the isolation of phages, and others were used for isolating Streptomyces spp [18].

2.2. Isolation and counting of streptomyces species

Streptomyces spp. were isolated and counted using the plate count technique as previously described [18,19]. Briefly, the soil samples were air-dried, heated at 100 °C for 1 h, dissolved in saline solutions, and serially diluted (up to 10 ⁻⁶). About 100 μL from each dilution was spread on the plates containing starch casein nitrate (SCN) agar medium (Oxid, USA) treated with cycloheximide (50 μg/mL) to prevent bacterial and fungal growth. The samples were kept for 7–21 days at 28 °C and the colonies were isolated in pure cultures and counted using SCN agar medium.

2.3. Screening for in vitro antibacterial activity of streptomyces species

The modified Kirby-Bauer disc diffusion method [20,21] was utilized to determine the antibacterial activity of isolated Streptomyces spp. culture against four reference bacterial strains obtained from the American Type Culture Collection (ATCC®; Manassas, VA, USA) including Listeria monocytogenes ATCC 35152, E. coli O157 ATCC 43895, Acinetobacter baumannii ATCC 17978, and Micrococcus luteus ATCC 9341, in addition to a previously identified methicillin resistant-vancomycin intermediate Staphylococcus aureus (MRSA-VISA) strain No. P59, which was previously isolated from a human post-operative pus sample according to a previous research study of one of the co-authors [22]. The information on the utilized reference bacteria was taken from the ATCC® database and Gene Bank. The M. luteus strain was grown in tryptone soy broth (Oxoid, UK) for 24–48 h at 37 °C, while the remaining four bacterial strains were cultivated in Brain Heart infusion broth (Oxoid, UK) for 24–48 h at 37 °C, before applying the disc diffusion method. The outcomes were defined as weak (zone diameter = 10 mm), moderate (11–20 mm), strong (21–30 mm), or very strong (≥31 mm) [23].

2.4. Characterization of the most potent streptomyces strain

2.4.1. Phenotypic characterization

The most potent Streptomyces strain was characterized phenotypically according to the standard methods [24,25] based on the shape of mycelium color, shape, substrate mycelium, melanin, and the soluble pigment production at 28 °C for seven days. Moreover, the ability of Streptomyces spp. to assimilate different carbon compounds (raffinose, sucrose, rhamnose, fructose, mannitol, inositol, xylose, arabinose, and glucose) as an energy source was performed using different International Streptomyces Project (ISP) media [26]. Finally, bright field light and scanning electron microscopy (SEM) were utilized to determine the morphological characteristics of the Streptomyces strain and its growth on SCN agar at 28 °C for four days [27,28].

2.4.2. Genotypic characterization

Extraction of DNA from the most potent Streptomyces strain was performed according to the protocol provided by Ref. [29]. One pair of universal oligonucleotide primers with the following sequence: f27 (5′AGAGTTTGATCATGGCTCAG 3′) and r1492 (5′ TACGGCTACCTTGTTACGACTT-3′) [30] were utilized in PCR technique for amplification of 16S rRNA gene, then the identities were verified via DNA sequencing in the forward and reverse directions by Applied Biosystems 3130 automated DNA sequencer (ABI, 3130, USA). The nucleotide sequences were compared to the other GenBank sequences via the NCBI BLAST tool (www.ncbi.nlm.nih.gov). DNA sequence results were analyzed using MEGA software version 6 [31]. Finally, the partial sequence of the 16S rRNA gene was submitted to NCBI GenBank (www.ncbi.nlm.nih.gov/genbank/) under accession number (PP752347).

2.5. Streptomyces phages

2.5.1. Isolation and propagation of streptomyces phages

The Streptomyces phages were isolated from seven soil samples with potential host isolate (the most potent Streptomyces strain) by enrichment procedure [17,32].

The phage samples’ purification was done via restreaking single plaques two times according to Hardy et al. [33], and Pajunen et al. [34]. Briefly, Streptomyces phage suspensions of high titer lysates were prepared by mixing 100 μL of the purified phage lysate into top agar to obtain confluent plate lysates. After incubating these plates overnight at 4 °C, the phages were resuspended with 3 mL saline, centrifuged, and the supernatant was filtered through a membrane (0.45 μm) to obtain the high-titer phage solution as determined by phage plaque titration using the following equation: phage titer = number of plaques x 10 reciprocal of dilution. Phage titer was expressed as plaques forming unit per ml (pfu/mL).

2.5.2. Morphological characterization of streptomyces phages via transmission electron microscopy (TEM)

Morphological assessment of the phages was performed by transmission electron microscopy. Samples were prepared from high titer lysates by depositing drops on 200-mesh copper grids with a carbon-coated collodion membrane. The grids were then negatively stained with a saturated solution of 2 % (w/v) aqueous uranyl acetate at pH 4.5. The excess stain was removed, and the grids were placed over a slide with the mounted specimen in a Petri dish. Transmission electron microscopy (TEM) was used to examine the samples to determine the morphology and size of the phage particles [35].

2.5.3. Streptomyces phages host range by spot assay

Streptomyces phages with the highest phage titer were spot-tested against the isolated Streptomyces strains with antibacterial activities. Phage host range (biological activity) was tested via a spot test technique as previously described [16,36]. Briefly, 20 μL of each Streptomyces phage (10⁵ pfu/mL) were placed on SCN agar media seeded with each strain of Streptomyces. The plates were incubated at 37 °C/7 days to investigate the presence of clear central zones. The existence of a lytic zone represented phage susceptibility to the tested strain.

2.5.4. Thermal and ultraviolet light stability assays of streptomyces phages

The effect of temperature on the viability of Streptomyces phages was studied by thermal inactivation point test as described previously [34]. Briefly, the filtered phage suspensions were diluted to approximately 2.3 × 10⁸ pfu/mL, then the plaques were counted to determine the virus titer. In sterile test tubes, 2 mL of phage suspension was incubated in a water bath for 10 min, at 40 °C, 50 °C, 60 °C, 70 °C, 80 °C, and 90 °C, after that, all tubes were cooled directly under a tap water for determining the survival of the phages by the by phage plaque titration assay.

The effect of UV light on the isolated Streptomyces phages was determined by exposing phage lysate to a UV lamp [37] and the survival of the phages was estimated by the phage plaque titration technique [33,34]. There were three biological replicates used in each experiment.

2.5.5. Adsorption and growth experiments of streptomyces phages

The adsorption of the phage to the host cell was determined as previously pronounced by Karumidze [38]. Phage suspensions were added to the spores of their indicator host (the most potent Streptomyces strain) and we determined the adsorption rate constant by using the following formula: K=2.3/BT log (Pο/P), where K: adsorption rate constant; B: bacterial host concentration (10⁷ CFU/ml), T: time (min), Po: unadsorbed phage concentration at the beginning, and P: unadsorbed phage concentration at the end.

One-step growth experiments were conducted as described previously [38,39]. Briefly, a mixture containing 30 mL of nutrient broth (NB; Oxid, USA), phage, and spore of the host was prepared to give a multiplicity of infection (MOI) of 0.01, then this suspension was incubated at 37 °C for adsorption. After incubation, the suspension was centrifuged at 4000 rpm and pellets were collected and resuspended in 10 mL of NB and incubated at 37 °C. At certain time intervals, 100 μL of the solution was collected and plated on soft agar with 100 μL of the host suspension. The observed number of phage particles was plotted against time, and the latent period, rise period, and phage burst size were determined. There were three biological replicates used in each experiment.

2.5.6. Restriction fragment length polymorphisms (RFLPs) analysis of streptomyces phage

Streptomyces phage lysate purification was performed by adding NaCl (1 M) to the lysate and leaving it overnight at 4 °C, then, the solution was centrifuged (4000 rpm for 30 min) to obtain polyethylene glycol (PEG)-phage pellet. The PEG-phage pellet was resuspended gently in 1 mL of (phosphate buffer saline) PBS and vortexed to be used for phage DNA extraction [40]. The phage DNA was extracted by the phenol-chloroform method as described previously [41,42]. Briefly, equal volumes of phenol and chloroform were added to the phage suspension, and the two phases were mixed and left for 24 h at 4 °C, then centrifuged. After centrifugation, the mixture yielded two phases: the lower organic phase and the upper aqueous phase containing DNA. The upper aqueous phase was collected and subjected to salt and isopropanol precipitation as earlier pronounced [43,44]. After that, the extracted DNA was subjected to restriction of DNA digestion with the EcoRI and HindIII enzymes and agarose gel electrophoresis according to the standard methods [39,40]. Restriction endonucleases and buffers were purchased from New England Biolabs (Japan).

2.6. Attempet to develop streptomyces phage-resistant strain and testing its antibacterial activities

We attempted to develop a resistant Streptomyces strain against the isolated Streptomyces phages as previously described by Ref. [16]. Briefly, Streptomyces phages with the highest phage titer were spot-tested against the host strain (the most potent Streptomyces strain), and two methods were used to investigate the ability of the host strain to resist the isolated phages. After that, phage samples of the completely lysed broth cultures and the secondary growth colony which developed inside the plaque after incubation for 7–10 days at 37 ^°C were picked up and purified on SCN agar plates. Additionally, confluent plates were cultured with host strain, and isolated Streptomyces phages, then incubated for 7 days at 37 ^°C. After that, colonies with no-lytic area were picked up to obtain Streptomyces phages-resistant strain. The Streptomyces phage-resistant strain was re-purified on the SCN agar plate by re-streaking five times under sterile conditions, then colonies were picked up and sub-cultured in slants. There were three biological replicates used in each experiment.

The purified Streptomyces phage-resistant strain and the original host strain (wild strain) were investigated for their antimicrobial activity against the tested bacterial strains as described previously in section 2.3.

2.7. Active metabolites of streptomyces phage-resistant strain

2.7.1. Extraction of streptomyces strain active metabolites

The active metabolites of the phage-resistant Streptomyces strain were produced via maturation of broth in 200-mL flasks containing 100 mL of ISP-2 medium with slant culture of Streptomyces phage-resistant strain at 30 °C for five days with constant shaking at 200 rpm. After incubation, the flasks were collected, and the biomass was separated from the culture broth by centrifugation at 8000 rpm for 15 min vigorously shaken by a flask shaker, after that, filtered utilizing Whatman No. 1 filter paper. The extracted metabolites were concentrated using a rotating evaporator, redissolved in 96 % ethanol (I mL) for washing, and stored at −20 °C [45].

2.7.2. Identification and antimicrobial activities of the extracted active metabolite

The structure of the extracted active metabolite was determined using spectroscopic techniques and physicochemical properties were examined consistently with quality steps [24,25]. Thin-layer chromatography (TLC) (Sigma-Aldrich, Germany) was utilized to examine the extracted metabolite initially on silica gel paper chromatography, then we calculated the rate of flow (Rf) values [45]. Pre-coated TLC sheets were used in TLC to fractionate the resulting metabolite for identifying antibiotics. Using the disc diffusion assay, the resulting fraction was dissolved in diethyl ether to test its bioactivity [46].

The gas chromatography-mass spectrometry (GC-MS) was utilized to test the active metabolites via a TRACE GC Ultra Gas Chromatograph (THERMO Scientific Corp., USA) and a thermal mass spectrometer detector (ISQ Single Quadrupole Mass Spectrometer) with diethylester as a solvent [47], then the results were confirmed utilizing nuclear magnetic radiation spectrum (NMR), and Infrared (IR) spectroscopy.

The NMR spectroscopy is an analytical tool used to gather precise structural and quantitative data regarding the metabolites generated and chloroform was utilized as a solvent in this spectrum. The acquired data were compared with similar substances generated by Streptomyces spp [48]. The IR spectrophotometer (ThermoFisher Nicolete IRIS10- USA) was used to scan the IR spectrum of the compound between 4000 and 400 cm⁻¹ utilizing diethyl ether. Plotting the spectra as intensity against wave number was done. The maximum and minimum resolution, in addition to, the quantity of peaks were determined in this spectral region [49].

The modified Kirby-Bauer disc diffusion method was used to examine the antimicrobial potential of the extracted active metabolites against various bacteria as previously described in section 2.3.

2.8. Statistical analysis

All experimental procedures were done in triplicate except amplification of the 16S rRNA gene and phylogenetic analysis. Analysis of results was done using the independent sample T-test, one-way analysis of variance (ANOVA), and Post-hoc Tukey's test by SPSS software version 18.0 (SPSS Inc., Chicago, USA). The results were expressed as mean ± standard error (SE), and the significance level was set at p < 0.05.

3. Results

3.1. Identification and antibacterial activity of streptomyces species

According to the conventional identification methods, a total of 58 Streptomyces isolates were obtained from various rhizosphere soil samples collected from different localities in Egypt.

All 58 Streptomyces isolates were tested for their antibacterial activities against five pathogenic bacterial strains including L. monocytogenes, E. coli O157, A. baumannii, MRSA-VISA, and M. luteus as presented in Supplementary Table 1 and Supplementary Fig. 1A. It has been found that 10 (17.2 %) Streptomyces isolates showed antibacterial activities against the tested bacteria. Of note, Streptomyces isolate with code no. ZA57 was the most potent Streptomyces isolate as it showed strong antibacterial activities against MRSA-VISA and M. luteus and moderate antibacterial activities against L. monocytogenes, E. coli O157, and A. baumannii, thus, it was selected for further investigations.

3.2. Characterization of the most potent streptomyces strain

According to the ISP phenotypic identification results, the most potent Streptomyces isolate (code no. ZA57) grew well and showed dark brownish aerial mycelium with heavy white and gray spores on SCN agar plates (Supplementary Fig. 1A), but it did not grow on ISP-6 media. ZA57 isolate produced gray conidia and brown to dark brown substrate mycelium with no soluble or melanin pigments on ISP2, ISP3, ISP4, and ISP-5 media. The sporulation rate was high, good, good, and low in the ISP-2, ISP-3, ISP-4, and ISP-5 media, respectively. On ISP-7 media, the ZA57 isolate produced only gray conidia with a low sporulation rate (Supplementary Table 2).

The capability of the ZA57 strain to assimilate different carbon compounds as energy sources was determined by heavy growth on ISP media supplemented separately with all the tested carbon compounds and the ZA57 strain was identified as S. abietis (group I Streptomyces spp.). Moreover, the bright field light microscopy showed that spores were spiral with hook ends (Supplementary Fig. 1B) and SEM presented that spores were visible as a spiny surface (Supplementary Fig. 1C).

The 16S rRNA gene sequencing of the obtained isolates confirmed the identification of S. abietis and it was submitted to NCBI GeneBank under accession number (PP752347) (Figure 1).

3.3. Isolation and morphology of streptomyces phages from different soil samples

Phage activity was determined in only one batch of the seven tested soil samples against the most potent Streptomyces isolate (code no. ZA57). Three lytic bacteriophages active against the ZA57 strain were isolated and these phages were named (ϕPRSC1, ϕPRSC2, and ϕPRSC4.

The plaque morphology of the three isolated Streptomyces phages showed various sizes, with a clear plaque center and translucent surrounding area (Table 1).

Table 1. Morphological characteristics of the Streptomyces phages isolated from the soil samples.

Phage code no.	Family	Plaque Morphology (mm)^a
		Petri-dish		TEM
		Size	Appearance	Head	Tail
ϕPRSC1	Podoviridae	1.90 ± 0.49^b	Clear center and area	73.83 ± 0.92^a	24.17 ± 0.60^c
ϕPRSC2	Siphoviridae	2.77 ± 0.14^b	Clear center and area	51.17 ± 0.60^b	200.50 ± 0.28^a
ϕPRSC4	Siphoviridae	4.50 ± 0.28^a	Clear center and area	49.50 ± 0.28^b	100.50 ± 0.28^b

TEM: transmission electron microscope.

^{a, b, c} Means within the same column carrying different superscripts are significantly different at (p < 0.05).

a: The results were expressed as mean ± standard error.

The morphological characterization of the three isolated phages was detected using TEM, enabling their categorization into the Caudovirales order and the Podoviridae and Siphoviridae families.

The phage ϕPRSC1 showed typical traits of a podovirus with a 75 nm hexagonal head and a short tail. The phages ϕPRSC2 and ϕPRSC4 were morphologically siphoviruses as they exhibited 50 nm isometric head-long non-contractile (Fig. 2).

3.4. Host range of the isolated streptomyces phages

The three isolated Streptomyces phages were spot-tested against 10 obtained Streptomyces isolates with antibacterial activities to determine their hast range. The results showed that the three isolated phages were infectious and had a wide range of hosts (Table 2).

Table 2. Host range of the isolated Streptomyces phages against different Streptomyces isolates.

Isolate code no.	Lytic area by spot test			Morphological characterization
Isolate code no.	ϕPRSC1	ϕPRSC2	ϕPRSC4	Morphological characterization
ZA57 (host isolate)	+	+	+	Gray spore-forming with brownish substrate mycelium
CA12	+	+	+	Gray spore-forming with colorless substrate mycelium
CA53	+	+	+	Gray spore with yellowish substrate mycelium
FA18	+	+	-	Gray spore with colorless substrate mycelium
MA13	-	+	-	White spore-forming with colorless substrate mycelium
MA60	-	-	+	Olive series
ZA16	+	+	+	Gray spore-forming with brownish mycelium
ZA27	-	+	-	White spore with colorless substrate mycelium
ZA47	-	+	-	White spore with colorless substrate mycelium
ZA67	+	-	-	Gray spore with colorless substrate mycelium

3.5. Thermal and ultraviolet light stability of the three streptomyces phages

The investigation of the stability of the three Streptomyces phages was conducted in various temperature and UV light circumstances relying on input and residual pfu levels. The three Streptomyces phages were thermostable at 60 °C for 7 h, and phage inactivation was detected after exposure to temperatures above 60 °C for 10 min. Interestingly, ϕPRSC4 was thermostable at 70 °C for 10 min and ϕPRSC2 was thermostable at 90 °C for 10 min (Fig. 3).

Similarly, exposure of the three Streptomyces phages to UV irradiation for more than 120 min made them inactive, and their ability to infect was lost (Fig. 3). Of note, ϕPRSC4 was UV-stable for 80 min, ϕPRSC1 was UV-stable for 100 min, and ϕPRSC2 was UV-stable for 120 min (Fig. 4).

3.6. Streptomyces phages infection kinetics

The three Streptomyces phages had effective adsorption durations when tested against the ZA57 strain (host strain) (Fig. 5). Adsorption rate constants for ϕPRSC1, and ϕPRSC4 were 99.7, and 99.5 %, respectively after 4 min, meanwhile, it was 99.9 % after 5 min for ϕPRSC2.

The results of the one-step growth assay utilizing the ZA57 strain (host strain) showed that the latent periods of ϕPRSC1, ϕPRSC2, and ϕPRSC4 were approximately 14, 15, and 24 min, respectively, with corresponding burst sizes of 20 pfu/cell. On the other hand, the rise period of ϕPRSC1 was 10 min, while it was 15 min for both ϕPRSC2 and ϕPRSC4 phages (Fig. 6).

3.7. Restriction fragment length polymorphisms (RFLPs) analysis of streptomyces phages genome

The DNA of the ϕPRSC1 and ϕPRSC4 phages were resistant to digestion by EcoRI and HindIII, but the DNA of ϕPRSC2 was resistant to digestion by EcoRI and sensitive to digestion by HindIII (Supplementary Fig. 2).

3.8. Attempt to develop streptomyces phage-resistant strain and test its antibacterial activities

The spot test results showed that the colonies developed from complete lyses plates or streaked lysed broth culture appeared to be lysed in the center and, when these colonies were re-streaked on SCN plates, no growth of S. abietis colonies was observed. Meanwhile, colonies grown on SCN plates after re-streaking by a loop of the precipitate obtained from the lysed broth did not have a lysed center (resistant Streptomyces strain).

The Susceptibility of the resistant Streptomyces strain to ϕPRSC1, ϕPRSC2, and ϕPRSC4 was not observed (Table 3), meanwhile, the original host strain (ZA57) was susceptible to the three Streptomyces phages. The phage-resistant S. abietis isolate showed a significant increase in antimicrobial activity than the original S. abietis strain (p > 0.001). Of note, the antibacterial activities of the phage-resistant isolate were twice that of the ZA57 strain (wild strain) (Table 3). The resistant strain was reidentified by phenotypic basic on ISP methods and molecular tests to ensure this strain was identical to the sensitive strain.

Table 3. Antimicrobial activities of phage-resistant Streptomyces abietis compared with a sensitive one.

Streptomyces strains	Susceptibility to isolated phages			Diameter of inhibition zone (mm)^a
	Susceptibility to isolated phages			A. baumannii	E. coli O157	MRSA-VISA	L. monocytogenes	M. luteus
	ϕPRSC1	ϕPRSC2	ϕPRSC4	A. baumannii	E. coli O157	MRSA-VISA	L. monocytogenes	M. luteus
Original host strain (ZA57)	S	S	S	20 ± 1	20.33 ± 1.52	30 ± 1.73	20 ± 1.52	25 ± 1.52
Phage-resistant Streptomyces strain	R	R	R	40.33 ± 1.52	42 ± 2	42.33 ± 1.52	40.0 ± 2	40.33 ± 1.52
p-value				>0.001	>0.001	>0.001	>0.001	>0.001

MRSA-VISA: methicillin resistant-vancomycin-intermediate Staphylococcus aureus, S: susceptible, R: Resistant.

a: The results were expressed as mean ± standard error.

3.9. Identification and antimicrobial activities of streptomyces active metabolites

The active metabolites were extracted from the Streptomyces phage-resistant strain. Using chemo-physical tools including TLC, GC-MS, IR, and NMR, the structural compounds and functional groups of the active metabolite were clearly demonstrated. The TLC analysis of active metabolite extract showed two fractions with antibacterial efficacy against the examined microorganisms. The Rf values of the two fractions were 0.5 and 0.52. The GC-MS analysis was conducted on the purified extract from TLC, and it recognized telomycin as an antibacterial metabolite extracted from phage-resistant S. abietis strain (Fig. 7) when compared with the chemical structure of telomycin as reported by Sheehan et al. [50] (Supplementary Fig. 3). Additionally, NMR analysis shows that this purified extract is mostly telomycin, where the ¹H₁ NMR spectrum showed,

δ

$δ$ , ppm: 0.93–0.789 (m, aliphatic, J = 7.5Hz), 1.7–1.8 (m, O

= H

$= H$ , J = 97.5Hz), 2.0–2.1 (m, O

= H

$= H$ , J = 35.5Hz) (Fig. 8). The IR spectrum of the metabolite extract exhibited absorption spectra at 2981, 2865, 1056, 1010, and 520 for (Ʋ OH), (Ʋ CH aliphatic), (Ʋ C

=

$=$ O), (amide), and (Ʋ C

=

$=$ C), respectively (Fig. 9), which suggest that purified extract is mostly telomycin.

Of note, telomycin exhibited very strong and strong antibacterial activities with a maximum zone of inhibition against the tested Gram-positive bacteria including MRSA-VISA (41 mm), M. luteus (38 mm), and L. monocytogenes (27 mm), meanwhile, it showed weak activities against E. coli O157 (10 mm) and A. baumannii (9 mm).

4. Discussion

Lately, MDR bacteria have been considered the leading cause of illness and mortality worldwide [[51], [52], [53], [54]]. Hence, it is necessary to discover effective novel bioactive compounds from microbial sources such as Streptomyces spp. as substitute medications to combat MDR microorganisms, which cause both existing and reemerging diseases worldwide [9,16]. However, Actinomyces bacteriophage contamination in the pharmaceutical industries led to low-quality end-products and economic losses. Therefore, it is vital to find an approach to discover phage-resistant strains to diminish the risks of phage-induced problems in different industries [13]. Keeping this in mind, the current study aimed to isolate and characterize Streptomyces spp. and Streptomyces phages from various rhizospheric soil samples in Egypt, and investigate their antibacterial activities, in addition to developing a Streptomyces phage-resistant strain to extract its active metabolites and test its antibacterial activity.

Screening the antibacterial activities of the isolated 58 Streptomyces isolates showed that 10 (17.2 %) Streptomyces isolates had antibacterial activities against the tested bacteria, which is consistent with the results of previous studies conducted in Iran [55], India [56], and Nepal [57], where the isolated Streptomyces spp. exhibited broad-spectrum antibacterial activities against the tested Gram-positive and Gram-negative bacteria including E. coli, Salmonella typhi, S. aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris, S. paratyphi, and Bacillus cereus. These antibacterial activities could be linked to the presence of bioactive compounds with antimicrobial activities [57]. Herein, we used morphological and physiological properties in conjunction with genetic techniques to identify the most active S. abietis strain (code no. ZA57), and the most effective media were ISP-2, ISP-3, ISP-4, and ISP-7. Our findings are in complete agreement with those of previous studies conducted in India [58], and Slovakia [59]. These results could be attributed to the presence of malt and yeast extract and glucose in ISP media which are considered sources of organic nitrogen and simple carbon that could boost Streptomyces growth and pigment formation, in addition to stimulating the synthesis of antibacterial compounds [18].

In the current work, three lytic bacteriophages belonging to the families Siphoviridae and Podoviridae were obtained from the rhizospheric soil samples and further characterized. The three isolated Streptomyces phages were infectious and had a wide range of hosts against the 10 tested Streptomyces isolates with antibacterial activities. In accordance, a recent study reported the isolation of five siphovirus Streptomyces phages from soil samples with a broad host range against the tested Streptomyces strains [33]. In agreement with our outcomes, a previous report showed different latency periods of the five obtained Streptomyces phages (17–45 min) with burst sizes 109–196 pfu/cell, and the adsorption rate constants were 90–98 % [60]. In the current work, the three isolated Streptomyces phages were thermostable at 60 °C, and phage inactivation was detected at temperatures above 60 °C. In agreement, a recent study reported that Streptomyces phage was thermostable at 70 °C, and it was inactivated at a temperature higher than 85 °C [61]. Furthermore, a previous report conducted in Bulgaria stated that UV irradiation for 120 min led to the inactivation of bacteriophages causing them to lose their capability to infect [62], which was consistent with our outcomes, where the exposure of the three Streptomyces phages to UV irradiation for more than 120 min made them inactive, and their ability to infect was lost. These outcomes could be attributed to damaging the protein capsid and loosening of the protein-DNA interaction [63].

Of note, the RFLPs analysis of the Streptomyces phage genome showed that the DNA of the ϕPRSC1 and ϕPRSC4 phages were resistant to digestion by EcoRI and HindIII, but the DNA of ϕPRSC2 was resistant to digestion by EcoRI and sensitive to digestion by HindIII, these results are similar with that of a recent report conducted by Bumunang et al. [64], which exhibited that among the 10 examined bacteriophages, seven were resistant to digestion by EcoRI and HindIII enzymes. The ability of bacteriophages to resist digestion by restriction enzymes could be explained by the alteration or absence of the restriction site to prevent its recognition by certain enzymes [64].

Herein, we developed a resistant S. abietis strain against the three isolated Streptomyces phages. Interestingly, the antibacterial activities of the phage-resistant isolate were twice that of the original ZA57 strain. In accordance, a previous study reported the development of a phage-resistant strain of S. mediterranei, and this strain not only eliminated the phage but also significantly increased rifamycin yields [16]. Similarly, a recent study stated that the effect of phage infection on 12 Streptomyces spp. is different as some Streptomyces spp. are very sensitive to infection by bacteriophages, while others are highly resistant to bacteriophage infection [65]. The mechanism of phage resistance in Streptomyces strains could be either through developmentally regulated mechanisms of resistance within the bacteria or perhaps through lysogen formation, or mutations in the bacteria that confer resistance [65].

Telomycin is a 3-hydroxyproline-containing peptide antibiotic that was isolated from Streptomyces in 1958. It exhibits various bioactivities, such as antibacterial, antifungal, immunosuppressive, and antitumor activities [28]. Herein, the TLC, GC-MS, IR, and NMR analysis of the purified active metabolite extract recognized telomycin as an antibacterial metabolite extracted from the phage-resistant S. abietis strain. Telomycin was potent against the tested Gram-positive bacteria. Similarly, a previous study conducted in India stated that spectrometric studies including TLC, GC-MS, IR, and NMR identified the purified active metabolite extract of Streptomyces parvulus as actinomycin D, which had antibacterial activities against streptomycin-resistant bacteria including B. cereus, P. putida and P. mirabilis [66]. In accordance, a previous report showed that telomycin had antibacterial activities against resistant Gram-positive pathogens including VISA, MRSA, and vancomycin-resistant Enterococcus faecium [13]. Likewise, earlier literature carried out in Canada showed that telomycin had antibacterial activities against Gram-positive bacteria including B. subtilis and S. aureus [67]. These findings could be linked to the ability of telomycin to prevent cardiolipin in the bacterial cytoplasmic membrane, which explains its selective bactericidal activities against Gram-positive bacteria [68,69].

5. Conclusions

Streptomyces abietis phage-resistant strain exhibited broad-spectrum antibacterial activities against the tested Gram-positive and Gram-negative bacteria, which could overcome the recurring issues of Streptomyces bacteriophage contamination during the pharmaceutical industries. Telomycin is an antibacterial metabolite extracted from phage-resistant S. abietis strain and it was potent against the tested Gram-positive bacteria including L. monocytogenes, MRSA-VISA, and M. luteus. Thus, it creates new opportunities for researching substitute antimicrobial medications for both existing and reemerging illnesses.

Funding

This research was funded by Taif University, Saudi Arabia, Project No. TU-DSPP-2024-192.

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Ethics statement

The study was reviewed and approved by Institutional Animal Care and Use Committee at Ain-Shams University, Egypt (approval number ASU-SCI/MICR/2023/9/5).

CRediT authorship contribution statement

Rewan Abdelaziz: Formal analysis, Data curation, Conceptualization. Marwa I. Abd El-Hamid: Validation, Supervision, Methodology, Investigation, Data curation, Conceptualization. Nahed El-Wafaei: Investigation, Formal analysis. Mohamed F. Ghaly: Data curation, Conceptualization. Ahmed Askora: Methodology, Formal analysis. Gamal EL-Didamony: Software, Resources. Sabah A. AboElmaaty: Supervision, Software. Tamer A. Ismail: Validation, Supervision. Doaa Ibrahim: Visualization, Validation. Samar A. Eissa: Visualization, Validation, Resources.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

The authors extend their appreciation to Taif University, Saudi Arabia for supporting this work through project number TU-DSPP-2024-192.

Appendix A. Supplementary data

The following is the Supplementary data to this article:Download: Download Word document (899KB)

Multimedia component 1.

References

[1]
M.I. Abd El-Hamid, M.M. El-Azzouny, R.M.S. El-Malt, M.E. Elkenawy, A.A. Abdelwarith, E.M. Younis, W. Youssef, R.E. Dawod, D.W.A.H. Elged, M.A.M. Habaka, A.S.A. El Oksh, S. Mekawy, S.J. Davies, D. Ibrahim
Future impact of thymoquinone-loaded nanoemulsion in rabbits: prospects for enhancing growth, immunity, antioxidant potential and resistance against Pasteurella multocida
Front. Vet. Sci., 10 (2024), Article 1340964, 10.3389/fvets.2023.1340964
Google Scholar
[2]
G.A. Ibrahim, M. Mabrok, K.J. Alfifi, M. Alatawy, A.S. Al-otaibi, A.M. Alenzi, A.N. Abdel Rahman, R.M.S. El-Malt, S.A. Ibrahim, R.M. El-Tarabili, A.M. Algammal
Pathogenicity, resistance patterns, virulence traits, and resistance genes of re-emerging extensively drug-resistant (XDR) Aeromonas veronii in Oreochromis niloticus
Aquacult. Int. (2024), pp. 1-20, 10.1007/S10499-024-01498-0/METRICS
View in Scopus Google Scholar
[3]
S.M. Abdel-Raheem, M.I. Abd El-Hamid, D. Ibrahim, R.M.S. El-Malt, W.R. El-Ghareeb, H.A. Ismail, S.I. Al-Sultan, A.M.A. Meligy, R.M. Eltarabili
Future scope of plant-derived bioactive compounds in the management of methicillin-resistant Staphylococcus aureus: in vitro antimicrobial and antivirulence prospects to combat MRSA
Microb. Pathog., 183 (2023), Article 106301, 10.1016/J.MICPATH.2023.106301
View PDF View article View in Scopus Google Scholar
[4]
D. Ibrahim, S.E. Shahin, L.S. Alqahtani, Z. Hassan, F. Althobaiti, S. Albogami, M.M. Soliman, R.M.S. El-Malt, H.F. Al-Harthi, N. Alqadri, M.T. Elabbasy, M.I. Abd El-Hamid
Exploring the interactive effects of Thymol and thymoquinone: moving towards an enhanced performance, gross margin, immunity and aeromonas sobria resistance of nile Tilapia (Oreochromis niloticus)
Animals, 12 (2022), p. 3034, 10.3390/ani12213034
View in Scopus Google Scholar
[5]
A.M. Ammar, M.I.A. El-Hamid, Y.H. Mohamed, H.M. Mohamed, D.H.M. Al-khalifah, W.N. Hozzein, S. Selim, W.M. El-Neshwy, R.M.S. El-Malt
Prevalence and antimicrobial susceptibility of bovine mycoplasma species in Egypt
Biology, 11 (2022), p. 1083, 10.3390/BIOLOGY11071083
View in Scopus Google Scholar
[6]
Y.M. Hashem, M.I. Abd El-Hamid, N.F.S. Awad, D. Ibrahim, N.S. Elshater, R.M.S. El-Malt, W.H. Hassan, U.H. Abo-Shama, M.A. Nassan, S.M. El-Bahy, O.M. Samy, R.B. El Sharkawy, N. Algabri, S.S. Elnahriry
Insights into growth-promoting, anti-inflammatory, immunostimulant, and antibacterial activities of Toldin CRD as a novel phytobiotic in broiler chickens experimentally infected with Mycoplasma gallisepticum
Poultry Sci., 101 (2022), Article 102154, 10.1016/j.psj.2022.102154
View PDF View article View in Scopus Google Scholar
[7]
A. Aljazzar, M.I. Abd El-Hamid, R.M.S. El-Malt, W. Rizk El-Gharreb, S.M. Abdel-Raheem, A.M. Ibrahim, A.M. Abdelaziz, D. Ibrahim
Prevalence and antimicrobial susceptibility of Campylobacter species with particular focus on the growth promoting, immunostimulant and anti-Campylobacter jejuni activities of eugenol and trans-cinnamaldehyde mixture in broiler chickens
Animals, 12 (2022), p. 905, 10.3390/ANI12070905
View in Scopus Google Scholar
[8]
J.V. Pham, M.A. Yilma, A. Feliz, M.T. Majid, N. Maffetone, J.R. Walker, E. Kim, H.J. Cho, J.M. Reynolds, M.C. Song, S.R. Park, Y.J. Yoon
A review of the microbial production of bioactive natural products and biologics
Front. Microbiol., 10 (2019), Article 449147, 10.3389/FMICB.2019.01404/BIBTEX
Google Scholar
[9]
Y.L. Zhang, S. Li, D.H. Jiang, L.C. Kong, P.H. Zhang, J.D. Xu
Antifungal activities of metabolites produced by a termite-associated Streptomyces canus BYB02
J. Agric. Food Chem., 61 (2013), pp. 1521-1524, 10.1021/JF305210U/ASSET/IMAGES/MEDIUM/JF-2012-05210U_0005.GIF
Google Scholar
[10]
D. Nedialkova, M. Naidenova
Screening the Antimicrobial activity of Actinomycetes strains isolatedfrom Antarctica
J. Cult. Collect., 4 (2005), pp. 29-35
https://tspace.library.utoronto.ca/handle/1807/5200, Accessed 18th Jul 2024
Google Scholar
[11]
F.Z. Djebbah, N.A. Al-Dhabi, M.V. Arasu, L. Belyagoubi, F. Kherbouche, D.E. Abdelouahid, B. Ravindran
Isolation and characterisation of Streptomyces sp. Strain GLD25 with antimicrobial and antioxidant effects from Gueldaman cave (GLD1), Akbou-Algeria
J. King Saud Univ. Sci., 34 (2022), Article 101719, 10.1016/j.jksus.2021.101719
View PDF View article View in Scopus Google Scholar
[12]
S. Wei, W. Zhang, Z. Ji
Structure and antibacterial activity of ambobactin, a new telomycin-like cyclic depsipeptide antibiotic produced by Streptomyces ambofaciens F3
Mol, 20 (2015), pp. 16278-16289, 10.3390/MOLECULES200916278
View in Scopus Google Scholar
[13]
C. Fu, L. Keller, A. Bauer, M. Brönstrup, A. Froidbise, P. Hammann, J. Herrmann, G. Mondesert, M. Kurz, M. Schiell, D. Schummer, L. Toti, J. Wink, R. Müller
Biosynthetic studies of telomycin reveal new lipopeptides with enhanced activity
J. Am. Chem. Soc., 137 (2015), pp. 7692-7705, 10.1021/JACS.5B01794/SUPPL_FILE/JA5B01794_SI_001.PDF
View in Scopus Google Scholar
[14]
S. E, C. D
A bacteriophage in the streptomycin fermentation
‏, J. Bacteriol., 54 (1947), p. 41
41
https://europepmc.org/article/med/20344268, Accessed 18th Jul 2024
Google Scholar
[15]
H.B. Woodruff, T.D. Nunheimer, S.B. Lee
A bacterial virus for Actinomyces griseus
J. Bacteriol., 54 (1947), pp. 535-541
https://journals.asm.org/journal/jb, Accessed 18th Jul 2024
Crossref View in Scopus Google Scholar
[16]
J.E. Thiemann, C. Hengeller, A. Virgilio, O. Buelli, G. Licciardello
Rifamycin
Appl. Microbiol., 12 (1964), pp. 261-268, 10.1128/am.12.3.261-268.1964
View in Scopus Google Scholar
[17]
E.T. Montaño, J.F. Nideffer, L. Brumage, M. Erb, J. Busch, L. Fernandez, A.I. Derman, J.P. Davis, E. Estrada, S. Fu, D. Le, A. Vuppala, C. Tran, E. Luterstein, S. Lakkaraju, S. Panchagnula, C. Ren, J. Doan, S. Tran, J. Soriano, Y. Fujita, P. Gutala, Q. Fujii, M. Lee, A. Bui, C. Villarreal, S.R. Shing, S. Kim, D. Freeman, V. Racha, A. Ho, P. Kumar, K. Falah, T. Dawson, E. Enustun, A. Prichard, A. Gomez, K. Khanna, S. Trigg, K. Pogliano, J. Pogliano
Isolation and characterization of Streptomyces bacteriophages and Streptomyces strains encoding biosynthetic arsenals
PLoS One, 17 (2022), Article e0262354, 10.1371/JOURNAL.PONE.0262354
View in Scopus Google Scholar
[18]
D. Adam, M. Maciejewska, A. Naômé, L. Martinet, W. Coppieters, L. Karim, D. Baurain, S. Rigali
Isolation, characterization, and antibacterial activity of hard-to-culture actinobacteria from cave moonmilk deposits
Antibiotics (Berlin), 7 (2018), p. 28, 10.3390/ANTIBIOTICS7020028
View in Scopus Google Scholar
[19]
F.E. Clark
Agar-Plate method for total microbial count
Methods Soil Anal. Part 2 Chem. Microbiol. Prop., John Wiley & Sons, Ltd (2016), pp. 1460-1466, 10.2134/agronmonogr9.2.c48
View in Scopus Google Scholar
[20]
M.P. Weinstein
Performance Standards for Antimicrobial Susceptibility Testing
(30th ed.), Clinical and Laboratory Standards Institute, Wayne, Pa., USA (2020)
https://cir.nii.ac.jp/crid/1130566853765927296, Accessed 18th Jul 2024
Google Scholar
[21]
V.J. Boyle, M.E. Fancher, R.W. Ross
Rapid, modified kirby-bauer susceptibility test with single, high-concentration antimicrobial disks
Antimicrob. Agents Chemother., 3 (1973), pp. 418-424, 10.1128/AAC.3.3.418
View in Scopus Google Scholar
[22]
A. Osman, G. El-Didamony, M. Sitohy, M. Khalifa, G. Enan
Soybean glycinin basic subunit inhibits methicillin resistant-vancomycin intermediate Staphylococcus aureus (MRSA-VISA) in vitro
‏, Int. J. Appl. Res. Nat. Prod., 9 (2016), pp. 17-26
https://www.cabidigitallibrary.org/doi/full/10.5555/20163123849, Accessed 15th Jul 2024
View in Scopus Google Scholar
[23]
N. Sahin, A. Ugur
Investigation of the antimicrobial activity of some Streptomyces isolates
Turkish J. Biol., 27 (2003), pp. 79-84
View in Scopus Google Scholar
[24]
E.B. Shirling, D. Gottlieb
Methods for characterization of Streptomyces species
Int. J. Syst. Bacteriol., 16 (1966), pp. 313-340, 10.1099/00207713-16-3-313
View in Scopus Google Scholar
[25]
W.S. T., G. M., A. G.
Genus Streptomyces
S.T. Williams, M.E. Sharpe, J.G. Holt (Eds.), Bergey's Man. Syst. Bacteriol., Williams and Wilkins, Baltimore, MD (1989), pp. 2452-2492
https://www.cabidigitallibrary.org/doi/full/10.5555/19932293969
(accessed July 18, 2024)
Google Scholar
[26]
P. Rajeswari, P.A. Jose, R. Amiya, S.R.D. Jebakumar
Characterization of saltern based Streptomyces sp. and statistical media optimization for its improved antibacterial activity
Front. Microbiol., 5 (2014), 10.3389/FMICB.2014.00753
Google Scholar
[27]
A.I. Khattab, E.H. Babiker, H.A. Saeed
Streptomyces: isolation, optimization of culture conditions and extraction of secondary metabolites
Int. Curr. Pharmaceut. J., 5 (2016), pp. 27-32
https://www.researchgate.net/profile/Ahmed-Khattab-6/publication/293327884_Streptomyces_isolation_optimization_of_culture_conditions_and_extraction_of_secondary_metabolites/links/58bbfdb9aca27261e528ad2d/Streptomyces-isolation-optimization-of-culture-cond, Accessed 18th Jul 2024
Crossref Google Scholar
[28]
M. Thenmozhi, K. Kannabiran
Studies on isolation, classification and phylogenetic characterization of novel antifungal Streptomyces sp. VITSTK7 in India
Curr. Res. J. Biol. Sci., 2 (2010), pp. 306-312
https://www.researchgate.net/profile/Kannabiran-Krishnan/publication/49583000_Studies_on_Isolation_Classification_and_Phylogenetic_Characterization_of_Novel_Antifungal_Streptomyces_sp_VITSTK7_in_India/links/5810467808ae009606bb91bf/Studies-on-Isolation-Cl, Accessed 18th Jul 2024
Google Scholar
[29]
J. Marmur
A procedure for the isolation of deoxyribonucleic acid from micro-organisms
J. Mol. Biol., 3 (1961), p. 208, 10.1016/S0022-2836(61)80047-8
IN1
View PDF View article View in Scopus Google Scholar
[30]
I.S. Aytenov, T.A. Bozorov, D. Zhang, S.A. Samadiy, D.A. Muhammadova, M.Z. Isokulov, S.M. Murodova, O.R. Zakirova, B.K. Chinikulov, A.G. Sherimbetov
Uncovering the antifungal potential of plant-associated cultivable bacteria from the aral sea region against phytopathogenic fungi
Pathogens, 13 (2024), p. 585, 10.3390/PATHOGENS13070585
View in Scopus Google Scholar
[31]
S. Kumar, M. Nei, J. Dudley, K. Tamura
MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences
Briefings Bioinf., 9 (2008), pp. 299-306, 10.1093/BIB/BBN017
View in Scopus Google Scholar
[32]
P. Hyman
Phages for phage therapy: isolation, characterization, and host range breadth
Pharmaceuticals, 12 (2019), p. 35, 10.3390/PH12010035
View in Scopus Google Scholar
[33]
A. Hardy, V. Sharma, L. Kever, J. Frunzke
Genome sequence and characterization of five bacteriophages infecting Streptomyces coelicolor and Streptomyces venezuelae: alderaan, coruscant, dagobah, Endor1 and Endor2
Viruses, 12 (2020), p. 1065, 10.3390/V12101065
Google Scholar
[34]
M. Pajunen, S. Kiljunen, M. Skurnik
Bacteriophage ϕYeO3-12, specific for Yersinia enterocolitica serotype O:3, is related to coliphages T3 and T7
J. Bacteriol., 182 (2000), pp. 5114-5120, 10.1128/JB.182.18.5114-5120.2000/ASSET/0182AEFF-C4B8-42B5-A27A-A4DC6FC6026A/ASSETS/GRAPHIC/JB1800403006.JPEG
View in Scopus Google Scholar
[35]
S.E. Miller
Bioterrorism and electron microscopic differentiation of poxviruses from herpesviruses: dos and don’ts, ultrastruct
For. Pathol., 27 (2003), pp. 133-140, 10.1080/01913120309932
View in Scopus Google Scholar
[36]
S. Viazis, M. Akhtar, J. Feirtag, A.D. Brabban, F. Diez-Gonzalez
Isolation and characterization of lytic bacteriophages against enterohaemorrhagic Escherichia coli
J. Appl. Microbiol., 110 (2011), pp. 1323-1331, 10.1111/J.1365-2672.2011.04989.X
View in Scopus Google Scholar
[37]
G.H. Bowen
Studies of ultraviolet irradiation phenomena; an approach to the problems of bacteriophage reproduction
Cold Spring Harbor Symp. Quant. Biol., 18 (1953), pp. 245-253, 10.1101/SQB.1953.018.01.035
View in Scopus Google Scholar
[38]
N. Karumidze, I. Kusradze, S. Rigvava, M. Goderdzishvili, K. Rajakumar, Z. Alavidze
Isolation and characterisation of lytic bacteriophages of klebsiella pneumoniae and klebsiella oxytoca
Curr. Microbiol., 66 (2013), pp. 251-258, 10.1007/S00284-012-0264-7/FIGURES/5
View in Scopus Google Scholar
[39]
J.E. Dowding
Characterization of a bacteriophage virulent for Streptomyces coelicolor A3(2)
J. Gen. Microbiol., 76 (1973), pp. 163-176, 10.1099/00221287-76-1-163/CITE/REFWORKS
View in Scopus Google Scholar
[40]
J. Sambrook, E.F. Fritsch, T. Maniatis
Molecular Cloning: a Laboratory Manual
(second ed.), Cold Spring Harbor Laboratory Press, New York (1989)
Google Scholar
[41]
K.S. Kirby
A new method for the isolation of ribonucleic acids from mammalian tissues
Biochem. J., 64 (1956), p. 405, 10.1042/BJ0640405
View in Scopus Google Scholar
[42]
F.F. Barbier, T.G. Chabikwa, M.U. Ahsan, S.E. Cook, R. Powell, M. Tanurdzic, C.A. Beveridge
A phenol/chloroform-free method to extract nucleic acids from recalcitrant, woody tropical species for gene expression and sequencing
Plant Methods, 15 (2019), pp. 1-13, 10.1186/S13007-019-0447-3/FIGURES/9
View in Scopus Google Scholar
[43]
J. Crouse, D. Amorese
Ethanol precipitation: ammonium acetate as an alternative to sodium acetate
Focus, 9 (1987), pp. 3-5
https://scholar.google.com.eg/scholar?hl=ar&as_sdt=0%2C5&q=37.%09J.+Crouse+D.+Amorese%2C+Ethanol+precipitation%3A+ammonium+acetate+as+an+alternative+to+sodium+acetate.+Focus.+9%2C+%281987%29+3-5.&btnG=#d=gs_cit&t=1721293937207&u=%2Fscholar%3Fq%3Dinfo%3At7, Accessed 18th Jul 2024
Google Scholar
[44]
M.R. Green, J. Sambrook
Isolation of high-molecular-weight DNA using organic solvents
Cold Spring Harb. Protoc., 2017 (2017), 10.1101/PDB.PROT093450
pdb.prot093450
Google Scholar
[45]
H. Mohamed, B. Miloud, F. Zohra, J.M. García-Arenzana, A. Veloso, S. Rodríguez-Couto
Isolation and characterization of actinobacteria from Algerian sahara soils with antimicrobial activities
Int. J. Mol. Cell. Med., 6 (2017), p. 109, 10.22088/ACADPUB.BUMS.6.2.5
Google Scholar
[46]
I.N. Ogali, P.O. Okumu, E.O. Mungube, J.K. Lichoti, S. Ogada, G.K. Moraa, B.R. Agwanda, S.C. Ommeh
Genomic and pathogenic characteristics of virulent newcastle disease virus isolated from chicken in live bird markets and backyard flocks in Kenya
Internet J. Microbiol., 2020 (2020), Article 4705768, 10.1155/2020/4705768
View in Scopus Google Scholar
[47]
U. Managamuri, M. Vijayalakshmi, V.S.R.K. Ganduri, S.B. Rajulapati, B. Bonigala, B.S. Kalyani, S. Poda
Isolation, identification, optimization, and metabolite profiling of Streptomyces sparsus VSM-30
3 Biotech, 7 (2017), pp. 1-19, 10.1007/S13205-017-0835-1/METRICS
Google Scholar
[48]
D.N. Kirk, H.C. Toms, C. Douglas, K.A. White, K.E. Smith, S. Latif, R.W.P. Hubbard
A survey of the high-field 1 H NMR spectra of the steroid hormones, their hydroxylated derivatives, and related compounds
J. Chem. Soc. Perkin Trans., 2 (0) (1990), pp. 1567-1594, 10.1039/P29900001567
View in Scopus Google Scholar
[49]
T. Oki, M. Konishi, K. Tomatsu, K. Tomita, K.I. Saitoh, M. Tsunakawa, M. Nishio, T. Miyaki, H. Kawaguchi
Pradimicin, a novel class of potent antifungal antibiotics
J. Antibiot. (Tokyo), 41 (1988), pp. 1701-1704, 10.7164/ANTIBIOTICS.41.1701
View in Scopus Google Scholar
[50]
J.C. Sheehan, D. Mania, S. Nakamura, J.A. Stock, K. Maeda
The structure of telomycin
J. Am. Chem. Soc., 90 (1968), pp. 462-470, 10.1021/JA01004A043
View in Scopus Google Scholar
[51]
A. Ammar, M.I. Abd El-Hamid, Y.M. Hashem, R.M.S. El-Malt, H.M. Mohamed
Mycoplasma bovis: taxonomy, characteristics, pathogenesis and antimicrobial resistance
Zagazig Vet. J., 49 (2021), pp. 444-461, 10.21608/ZVJZ.2021.103834.1160
Google Scholar
[52]
A.M. Ammar, M.I. Abd El-Hamid, R.M.S. El-Malt, D.S. Azab, S. Albogami, M.M. Al-Sanea, W.E. Soliman, M.M. Ghoneim, M.M. Bendary
Molecular detection of fluoroquinolone resistance among multidrug-, extensively drug-, and pan-drug-resistant Campylobacter species in Egypt
Antibiotics, 10 (2021), p. 1342, 10.3390/ANTIBIOTICS10111342
View in Scopus Google Scholar
[53]
A.M. Ammar, E.-S.Y. El-Naenaeey, R.M.S. El-Malt, A.A. El-Gedawy, E. Khalifa, S.S. Elnahriry, M.I. Abd El-Hamid
Prevalence, antimicrobial susceptibility, virulence and genotyping of Campylobacter jejuni with a special reference to the anti-virulence potential of eugenol and beta-resorcylic acid on some multi-drug resistant isolates in Egypt
Animals, 1 (2021), Article 10003, 10.3390/ani11010003
Google Scholar
[54]
A.M. Ammar, E.-S.Y. El-Naenaeey, M.I.A. El-Hamid, A.A. El-Gedawy, R.M.S. El-Malt
Campylobacter as A major foodborne pathogen: a review of its characteristics, pathogenesis, antimicrobial resistance and control
J. Microbiol. Biotechnol. Food Sci., 10 (2021), pp. 609-619, 10.15414/JMBFS.2021.10.4.609-619
View in Scopus Google Scholar
[55]
A. Ramazani, S. Moradi, R. Sorouri, S. Javani, M. Garshasbi
Screening for antibacterial activity of Streptomyces species isolated from Zanjan province, Iran
Int. J. Pharmaceut. Chem. Biol. Sci., 3 (2013), pp. 342-349
https://www.researchgate.net/profile/Ali-Ramazani-2/publication/282671200_Screening_for_antibacterial_activity_of_streptomyces_species_isolated_from_zanjan_province_Iran/links/5617ec2008ae6d1730846f4d/Screening-for-antibacterial-activity-of-streptomyces-s, Accessed 18th Jul 2024
Google Scholar
[56]
M. Manimaran, J.V. Gopal, K. Kannabiran
Antibacterial activity of Streptomyces sp. VITMK1 isolated from mangrove soil of pichavaram, Tamil nadu, India
Proc. Natl. Acad. Sci. India B Biol. Sci., 87 (2017), pp. 499-506, 10.1007/S40011-015-0619-5/METRICS
View in Scopus Google Scholar
[57]
K. Khadayat, D.D. Sherpa, K.P. Malla, S. Shrestha, N. Rana, B.P. Marasini, S. Khanal, B. Rayamajhee, B.R. Bhattarai, N. Parajuli
Molecular identification and antimicrobial potential of Streptomyces species from Nepalese soil
Internet J. Microbiol., 2020 (2020), Article 8817467, 10.1155/2020/8817467
View in Scopus Google Scholar
[58]
R. Manikkam, G. Venugopal, B. Subramaniam, B. Ramasamy, V. Kumar
Bioactive potential of actinomycetes from less explored ecosystems against Mycobacterium tuberculosis and other nonmycobacterial pathogens
Int. Sch. Res. Notices, 2014 (2014), Article 812974, 10.1155/2014/812974
Google Scholar
[59]
I. Charousova, J. Medo, E. Halenárová, S. Javoreková
Antimicrobial and enzymatic activity of actinomycetes isolated from soils of coastal islands
\"J. Adv. Pharm. Technol. Research\"\" (JAPTR)\", 8 (2017), p. 46, 10.4103/JAPTR.JAPTR_161_16
View in Scopus Google Scholar
[60]
M.K. Mirzaei, A.S. Nilsson
Isolation of phages for phage therapy: a comparison of spot tests and efficiency of plating analyses for determination of host range and efficacy
PLoS One, 10 (2015), Article e0118557, 10.1371/JOURNAL.PONE.0118557
View in Scopus Google Scholar
[61]
N. Lu, C. Kim, Z. Chen, Y. Wen, Q. Wei, Y. Qiu, S. Wang, Y. Song
Characterization and genome analysis of the temperate bacteriophage ϕSAJS1 from Streptomyces avermitilis
Virus Res., 265 (2019), pp. 34-42, 10.1016/J.VIRUSRES.2019.03.006
View PDF View article View in Scopus Google Scholar
[62]
Y. Kizheva, M. Eftimova, R. Rangelov, N. Micheva, Z. Urshev, I. Rasheva, P. Hristova
Broad host range bacteriophages found in rhizosphere soil of a healthy tomato plant in Bulgaria
Heliyon, 7 (2021), Article e07084, 10.1016/j.heliyon.2021.e07084
View PDF View article View in Scopus Google Scholar
[63]
J. Anne, L. Van Mellaert, B. Decock, J. Van Damme, A. Van Aerschot, P. Herdewijn, H. Eyssen
Further biological and molecular characterization of actinophage VWB
J. Gen. Microbiol., 136 (1990), pp. 1365-1372, 10.1099/00221287-136-7-1365/CITE/REFWORKS
View in Scopus Google Scholar
[64]
E.W. Bumunang, T.A. McAllister, K. Stanford, H. Anany, Y.D. Niu, C.N. Ateba
Characterization of non-O157 STEC infecting bacteriophages isolated from cattle faeces in north-west South Africa
Microorganisms, 7 (2019), p. 615, 10.3390/MICROORGANISMS7120615
View in Scopus Google Scholar
[65]
S. Kronheim, E. Solomon, L. Ho, M. Glossop, A.R. Davidson, K.L. Maxwell
Complete genomes and comparative analyses of Streptomyces phages that influence secondary metabolism and sporulation
Sci. Rep., 13 (2023), pp. 1-11, 10.1038/s41598-023-36938-z
Google Scholar
[66]
P.R. Shetty, S.K. Buddana, V.B. Tatipamula, Y.V.V. Naga, J. Ahmad
Production of polypeptide antibiotic from Streptomyces parvulus and its antibacterial activity
Braz. J. Microbiol., 45 (2014), pp. 303-312, 10.1590/S1517-83822014005000022
View in Scopus Google Scholar
[67]
C.W. Johnston, M.A. Skinnider, C.A. Dejong, P.N. Rees, G.M. Chen, C.G. Walker, S. French, E.D. Brown, J. Berdy, D.Y. Liu, N.A. Magarvey
Assembly and clustering of natural antibiotics guides target identification
Nat. Chem. Biol., 12 (2016), pp. 233-239, 10.1038/nchembio.2018
View in Scopus Google Scholar
[68]
S. Wei, W. Zhang, Z. Ji
Structure and antibacterial activity of ambobactin, a new telomycin-like cyclic depsipeptide antibiotic produced by Streptomyces ambofaciens F3
Molecules, 20 (2015), pp. 16278-16289, 10.3390/MOLECULES200916278
View in Scopus Google Scholar
[69]
C.W. Johnston, M.A. Skinnider, C.A. Dejong, P.N. Rees, G.M. Chen, C.G. Walker, S. French, E.D. Brown, J. Berdy, D.Y. Liu, N.A. Magarvey
Assembly and clustering of natural antibiotics guides target identification
Nat. Chem. Biol., 2 (12) (2016), pp. 233-239, 10.1038/nchembio.2018
View in Scopus Google Scholar

Cited by (0)

View Abstract

[1] [1]
M.I. Abd El-Hamid, M.M. El-Azzouny, R.M.S. El-Malt, M.E. Elkenawy, A.A. Abdelwarith, E.M. Younis, W. Youssef, R.E. Dawod, D.W.A.H. Elged, M.A.M. Habaka, A.S.A. El Oksh, S. Mekawy, S.J. Davies, D. Ibrahim
Future impact of thymoquinone-loaded nanoemulsion in rabbits: prospects for enhancing growth, immunity, antioxidant potential and resistance against Pasteurella multocida
Front. Vet. Sci., 10 (2024), Article 1340964, 10.3389/fvets.2023.1340964
Google Scholar

[2] [2]
G.A. Ibrahim, M. Mabrok, K.J. Alfifi, M. Alatawy, A.S. Al-otaibi, A.M. Alenzi, A.N. Abdel Rahman, R.M.S. El-Malt, S.A. Ibrahim, R.M. El-Tarabili, A.M. Algammal
Pathogenicity, resistance patterns, virulence traits, and resistance genes of re-emerging extensively drug-resistant (XDR) Aeromonas veronii in Oreochromis niloticus
Aquacult. Int. (2024), pp. 1-20, 10.1007/S10499-024-01498-0/METRICS
View in Scopus Google Scholar

[3] [3]
S.M. Abdel-Raheem, M.I. Abd El-Hamid, D. Ibrahim, R.M.S. El-Malt, W.R. El-Ghareeb, H.A. Ismail, S.I. Al-Sultan, A.M.A. Meligy, R.M. Eltarabili
Future scope of plant-derived bioactive compounds in the management of methicillin-resistant Staphylococcus aureus: in vitro antimicrobial and antivirulence prospects to combat MRSA
Microb. Pathog., 183 (2023), Article 106301, 10.1016/J.MICPATH.2023.106301
View PDF View article View in Scopus Google Scholar

[4] [4]
D. Ibrahim, S.E. Shahin, L.S. Alqahtani, Z. Hassan, F. Althobaiti, S. Albogami, M.M. Soliman, R.M.S. El-Malt, H.F. Al-Harthi, N. Alqadri, M.T. Elabbasy, M.I. Abd El-Hamid
Exploring the interactive effects of Thymol and thymoquinone: moving towards an enhanced performance, gross margin, immunity and aeromonas sobria resistance of nile Tilapia (Oreochromis niloticus)
Animals, 12 (2022), p. 3034, 10.3390/ani12213034
View in Scopus Google Scholar

[5] [5]
A.M. Ammar, M.I.A. El-Hamid, Y.H. Mohamed, H.M. Mohamed, D.H.M. Al-khalifah, W.N. Hozzein, S. Selim, W.M. El-Neshwy, R.M.S. El-Malt
Prevalence and antimicrobial susceptibility of bovine mycoplasma species in Egypt
Biology, 11 (2022), p. 1083, 10.3390/BIOLOGY11071083
View in Scopus Google Scholar

[6] [6]
Y.M. Hashem, M.I. Abd El-Hamid, N.F.S. Awad, D. Ibrahim, N.S. Elshater, R.M.S. El-Malt, W.H. Hassan, U.H. Abo-Shama, M.A. Nassan, S.M. El-Bahy, O.M. Samy, R.B. El Sharkawy, N. Algabri, S.S. Elnahriry
Insights into growth-promoting, anti-inflammatory, immunostimulant, and antibacterial activities of Toldin CRD as a novel phytobiotic in broiler chickens experimentally infected with Mycoplasma gallisepticum
Poultry Sci., 101 (2022), Article 102154, 10.1016/j.psj.2022.102154
View PDF View article View in Scopus Google Scholar

[7] [7]
A. Aljazzar, M.I. Abd El-Hamid, R.M.S. El-Malt, W. Rizk El-Gharreb, S.M. Abdel-Raheem, A.M. Ibrahim, A.M. Abdelaziz, D. Ibrahim
Prevalence and antimicrobial susceptibility of Campylobacter species with particular focus on the growth promoting, immunostimulant and anti-Campylobacter jejuni activities of eugenol and trans-cinnamaldehyde mixture in broiler chickens
Animals, 12 (2022), p. 905, 10.3390/ANI12070905
View in Scopus Google Scholar

[8] [8]
J.V. Pham, M.A. Yilma, A. Feliz, M.T. Majid, N. Maffetone, J.R. Walker, E. Kim, H.J. Cho, J.M. Reynolds, M.C. Song, S.R. Park, Y.J. Yoon
A review of the microbial production of bioactive natural products and biologics
Front. Microbiol., 10 (2019), Article 449147, 10.3389/FMICB.2019.01404/BIBTEX
Google Scholar

[9] [9]
Y.L. Zhang, S. Li, D.H. Jiang, L.C. Kong, P.H. Zhang, J.D. Xu
Antifungal activities of metabolites produced by a termite-associated Streptomyces canus BYB02
J. Agric. Food Chem., 61 (2013), pp. 1521-1524, 10.1021/JF305210U/ASSET/IMAGES/MEDIUM/JF-2012-05210U_0005.GIF
Google Scholar

[10] [10]
D. Nedialkova, M. Naidenova
Screening the Antimicrobial activity of Actinomycetes strains isolatedfrom Antarctica
J. Cult. Collect., 4 (2005), pp. 29-35
https://tspace.library.utoronto.ca/handle/1807/5200, Accessed 18th Jul 2024
Google Scholar

[11] [11]
F.Z. Djebbah, N.A. Al-Dhabi, M.V. Arasu, L. Belyagoubi, F. Kherbouche, D.E. Abdelouahid, B. Ravindran
Isolation and characterisation of Streptomyces sp. Strain GLD25 with antimicrobial and antioxidant effects from Gueldaman cave (GLD1), Akbou-Algeria
J. King Saud Univ. Sci., 34 (2022), Article 101719, 10.1016/j.jksus.2021.101719
View PDF View article View in Scopus Google Scholar

[12] [12]
S. Wei, W. Zhang, Z. Ji
Structure and antibacterial activity of ambobactin, a new telomycin-like cyclic depsipeptide antibiotic produced by Streptomyces ambofaciens F3
Mol, 20 (2015), pp. 16278-16289, 10.3390/MOLECULES200916278
View in Scopus Google Scholar

[13] [13]
C. Fu, L. Keller, A. Bauer, M. Brönstrup, A. Froidbise, P. Hammann, J. Herrmann, G. Mondesert, M. Kurz, M. Schiell, D. Schummer, L. Toti, J. Wink, R. Müller
Biosynthetic studies of telomycin reveal new lipopeptides with enhanced activity
J. Am. Chem. Soc., 137 (2015), pp. 7692-7705, 10.1021/JACS.5B01794/SUPPL_FILE/JA5B01794_SI_001.PDF
View in Scopus Google Scholar

[14] [14]
S. E, C. D
A bacteriophage in the streptomycin fermentation
‏, J. Bacteriol., 54 (1947), p. 41
41
https://europepmc.org/article/med/20344268, Accessed 18th Jul 2024
Google Scholar

[15] [15]
H.B. Woodruff, T.D. Nunheimer, S.B. Lee
A bacterial virus for Actinomyces griseus
J. Bacteriol., 54 (1947), pp. 535-541
https://journals.asm.org/journal/jb, Accessed 18th Jul 2024
Crossref View in Scopus Google Scholar

[16] [16]
J.E. Thiemann, C. Hengeller, A. Virgilio, O. Buelli, G. Licciardello
Rifamycin
Appl. Microbiol., 12 (1964), pp. 261-268, 10.1128/am.12.3.261-268.1964
View in Scopus Google Scholar

[17] [17]
E.T. Montaño, J.F. Nideffer, L. Brumage, M. Erb, J. Busch, L. Fernandez, A.I. Derman, J.P. Davis, E. Estrada, S. Fu, D. Le, A. Vuppala, C. Tran, E. Luterstein, S. Lakkaraju, S. Panchagnula, C. Ren, J. Doan, S. Tran, J. Soriano, Y. Fujita, P. Gutala, Q. Fujii, M. Lee, A. Bui, C. Villarreal, S.R. Shing, S. Kim, D. Freeman, V. Racha, A. Ho, P. Kumar, K. Falah, T. Dawson, E. Enustun, A. Prichard, A. Gomez, K. Khanna, S. Trigg, K. Pogliano, J. Pogliano
Isolation and characterization of Streptomyces bacteriophages and Streptomyces strains encoding biosynthetic arsenals
PLoS One, 17 (2022), Article e0262354, 10.1371/JOURNAL.PONE.0262354
View in Scopus Google Scholar

[18] [18]
D. Adam, M. Maciejewska, A. Naômé, L. Martinet, W. Coppieters, L. Karim, D. Baurain, S. Rigali
Isolation, characterization, and antibacterial activity of hard-to-culture actinobacteria from cave moonmilk deposits
Antibiotics (Berlin), 7 (2018), p. 28, 10.3390/ANTIBIOTICS7020028
View in Scopus Google Scholar

[19] [19]
F.E. Clark
Agar-Plate method for total microbial count
Methods Soil Anal. Part 2 Chem. Microbiol. Prop., John Wiley & Sons, Ltd (2016), pp. 1460-1466, 10.2134/agronmonogr9.2.c48
View in Scopus Google Scholar

[20] [20]
M.P. Weinstein
Performance Standards for Antimicrobial Susceptibility Testing
(30th ed.), Clinical and Laboratory Standards Institute, Wayne, Pa., USA (2020)
https://cir.nii.ac.jp/crid/1130566853765927296, Accessed 18th Jul 2024
Google Scholar

[21] [21]
V.J. Boyle, M.E. Fancher, R.W. Ross
Rapid, modified kirby-bauer susceptibility test with single, high-concentration antimicrobial disks
Antimicrob. Agents Chemother., 3 (1973), pp. 418-424, 10.1128/AAC.3.3.418
View in Scopus Google Scholar

[22] [22]
A. Osman, G. El-Didamony, M. Sitohy, M. Khalifa, G. Enan
Soybean glycinin basic subunit inhibits methicillin resistant-vancomycin intermediate Staphylococcus aureus (MRSA-VISA) in vitro
‏, Int. J. Appl. Res. Nat. Prod., 9 (2016), pp. 17-26
https://www.cabidigitallibrary.org/doi/full/10.5555/20163123849, Accessed 15th Jul 2024
View in Scopus Google Scholar

[23] [23]
N. Sahin, A. Ugur
Investigation of the antimicrobial activity of some Streptomyces isolates
Turkish J. Biol., 27 (2003), pp. 79-84
View in Scopus Google Scholar

[24] [24]
E.B. Shirling, D. Gottlieb
Methods for characterization of Streptomyces species
Int. J. Syst. Bacteriol., 16 (1966), pp. 313-340, 10.1099/00207713-16-3-313
View in Scopus Google Scholar

[25] [25]
W.S. T., G. M., A. G.
Genus Streptomyces
S.T. Williams, M.E. Sharpe, J.G. Holt (Eds.), Bergey's Man. Syst. Bacteriol., Williams and Wilkins, Baltimore, MD (1989), pp. 2452-2492
https://www.cabidigitallibrary.org/doi/full/10.5555/19932293969
(accessed July 18, 2024)
Google Scholar

[26] [26]
P. Rajeswari, P.A. Jose, R. Amiya, S.R.D. Jebakumar
Characterization of saltern based Streptomyces sp. and statistical media optimization for its improved antibacterial activity
Front. Microbiol., 5 (2014), 10.3389/FMICB.2014.00753
Google Scholar

[27] [27]
A.I. Khattab, E.H. Babiker, H.A. Saeed
Streptomyces: isolation, optimization of culture conditions and extraction of secondary metabolites
Int. Curr. Pharmaceut. J., 5 (2016), pp. 27-32
https://www.researchgate.net/profile/Ahmed-Khattab-6/publication/293327884_Streptomyces_isolation_optimization_of_culture_conditions_and_extraction_of_secondary_metabolites/links/58bbfdb9aca27261e528ad2d/Streptomyces-isolation-optimization-of-culture-cond, Accessed 18th Jul 2024
Crossref Google Scholar

[28] [28]
M. Thenmozhi, K. Kannabiran
Studies on isolation, classification and phylogenetic characterization of novel antifungal Streptomyces sp. VITSTK7 in India
Curr. Res. J. Biol. Sci., 2 (2010), pp. 306-312
https://www.researchgate.net/profile/Kannabiran-Krishnan/publication/49583000_Studies_on_Isolation_Classification_and_Phylogenetic_Characterization_of_Novel_Antifungal_Streptomyces_sp_VITSTK7_in_India/links/5810467808ae009606bb91bf/Studies-on-Isolation-Cl, Accessed 18th Jul 2024
Google Scholar

[29] [29]
J. Marmur
A procedure for the isolation of deoxyribonucleic acid from micro-organisms
J. Mol. Biol., 3 (1961), p. 208, 10.1016/S0022-2836(61)80047-8
IN1
View PDF View article View in Scopus Google Scholar

[30] [30]
I.S. Aytenov, T.A. Bozorov, D. Zhang, S.A. Samadiy, D.A. Muhammadova, M.Z. Isokulov, S.M. Murodova, O.R. Zakirova, B.K. Chinikulov, A.G. Sherimbetov
Uncovering the antifungal potential of plant-associated cultivable bacteria from the aral sea region against phytopathogenic fungi
Pathogens, 13 (2024), p. 585, 10.3390/PATHOGENS13070585
View in Scopus Google Scholar

[31] [31]
S. Kumar, M. Nei, J. Dudley, K. Tamura
MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences
Briefings Bioinf., 9 (2008), pp. 299-306, 10.1093/BIB/BBN017
View in Scopus Google Scholar

[32] [32]
P. Hyman
Phages for phage therapy: isolation, characterization, and host range breadth
Pharmaceuticals, 12 (2019), p. 35, 10.3390/PH12010035
View in Scopus Google Scholar

[33] [33]
A. Hardy, V. Sharma, L. Kever, J. Frunzke
Genome sequence and characterization of five bacteriophages infecting Streptomyces coelicolor and Streptomyces venezuelae: alderaan, coruscant, dagobah, Endor1 and Endor2
Viruses, 12 (2020), p. 1065, 10.3390/V12101065
Google Scholar

[34] [34]
M. Pajunen, S. Kiljunen, M. Skurnik
Bacteriophage ϕYeO3-12, specific for Yersinia enterocolitica serotype O:3, is related to coliphages T3 and T7
J. Bacteriol., 182 (2000), pp. 5114-5120, 10.1128/JB.182.18.5114-5120.2000/ASSET/0182AEFF-C4B8-42B5-A27A-A4DC6FC6026A/ASSETS/GRAPHIC/JB1800403006.JPEG
View in Scopus Google Scholar

[35] [35]
S.E. Miller
Bioterrorism and electron microscopic differentiation of poxviruses from herpesviruses: dos and don’ts, ultrastruct
For. Pathol., 27 (2003), pp. 133-140, 10.1080/01913120309932
View in Scopus Google Scholar

[36] [36]
S. Viazis, M. Akhtar, J. Feirtag, A.D. Brabban, F. Diez-Gonzalez
Isolation and characterization of lytic bacteriophages against enterohaemorrhagic Escherichia coli
J. Appl. Microbiol., 110 (2011), pp. 1323-1331, 10.1111/J.1365-2672.2011.04989.X
View in Scopus Google Scholar

[37] [37]
G.H. Bowen
Studies of ultraviolet irradiation phenomena; an approach to the problems of bacteriophage reproduction
Cold Spring Harbor Symp. Quant. Biol., 18 (1953), pp. 245-253, 10.1101/SQB.1953.018.01.035
View in Scopus Google Scholar

[38] [38]
N. Karumidze, I. Kusradze, S. Rigvava, M. Goderdzishvili, K. Rajakumar, Z. Alavidze
Isolation and characterisation of lytic bacteriophages of klebsiella pneumoniae and klebsiella oxytoca
Curr. Microbiol., 66 (2013), pp. 251-258, 10.1007/S00284-012-0264-7/FIGURES/5
View in Scopus Google Scholar

[39] [39]
J.E. Dowding
Characterization of a bacteriophage virulent for Streptomyces coelicolor A3(2)
J. Gen. Microbiol., 76 (1973), pp. 163-176, 10.1099/00221287-76-1-163/CITE/REFWORKS
View in Scopus Google Scholar

[40] [40]
J. Sambrook, E.F. Fritsch, T. Maniatis
Molecular Cloning: a Laboratory Manual
(second ed.), Cold Spring Harbor Laboratory Press, New York (1989)
Google Scholar

[41] [41]
K.S. Kirby
A new method for the isolation of ribonucleic acids from mammalian tissues
Biochem. J., 64 (1956), p. 405, 10.1042/BJ0640405
View in Scopus Google Scholar

[42] [42]
F.F. Barbier, T.G. Chabikwa, M.U. Ahsan, S.E. Cook, R. Powell, M. Tanurdzic, C.A. Beveridge
A phenol/chloroform-free method to extract nucleic acids from recalcitrant, woody tropical species for gene expression and sequencing
Plant Methods, 15 (2019), pp. 1-13, 10.1186/S13007-019-0447-3/FIGURES/9
View in Scopus Google Scholar

[43] [43]
J. Crouse, D. Amorese
Ethanol precipitation: ammonium acetate as an alternative to sodium acetate
Focus, 9 (1987), pp. 3-5
https://scholar.google.com.eg/scholar?hl=ar&as_sdt=0%2C5&q=37.%09J.+Crouse+D.+Amorese%2C+Ethanol+precipitation%3A+ammonium+acetate+as+an+alternative+to+sodium+acetate.+Focus.+9%2C+%281987%29+3-5.&btnG=#d=gs_cit&t=1721293937207&u=%2Fscholar%3Fq%3Dinfo%3At7, Accessed 18th Jul 2024
Google Scholar

[44] [44]
M.R. Green, J. Sambrook
Isolation of high-molecular-weight DNA using organic solvents
Cold Spring Harb. Protoc., 2017 (2017), 10.1101/PDB.PROT093450
pdb.prot093450
Google Scholar

[45] [45]
H. Mohamed, B. Miloud, F. Zohra, J.M. García-Arenzana, A. Veloso, S. Rodríguez-Couto
Isolation and characterization of actinobacteria from Algerian sahara soils with antimicrobial activities
Int. J. Mol. Cell. Med., 6 (2017), p. 109, 10.22088/ACADPUB.BUMS.6.2.5
Google Scholar

[46] [46]
I.N. Ogali, P.O. Okumu, E.O. Mungube, J.K. Lichoti, S. Ogada, G.K. Moraa, B.R. Agwanda, S.C. Ommeh
Genomic and pathogenic characteristics of virulent newcastle disease virus isolated from chicken in live bird markets and backyard flocks in Kenya
Internet J. Microbiol., 2020 (2020), Article 4705768, 10.1155/2020/4705768
View in Scopus Google Scholar

[47] [47]
U. Managamuri, M. Vijayalakshmi, V.S.R.K. Ganduri, S.B. Rajulapati, B. Bonigala, B.S. Kalyani, S. Poda
Isolation, identification, optimization, and metabolite profiling of Streptomyces sparsus VSM-30
3 Biotech, 7 (2017), pp. 1-19, 10.1007/S13205-017-0835-1/METRICS
Google Scholar

[48] [48]
D.N. Kirk, H.C. Toms, C. Douglas, K.A. White, K.E. Smith, S. Latif, R.W.P. Hubbard
A survey of the high-field 1 H NMR spectra of the steroid hormones, their hydroxylated derivatives, and related compounds
J. Chem. Soc. Perkin Trans., 2 (0) (1990), pp. 1567-1594, 10.1039/P29900001567
View in Scopus Google Scholar

[49] [49]
T. Oki, M. Konishi, K. Tomatsu, K. Tomita, K.I. Saitoh, M. Tsunakawa, M. Nishio, T. Miyaki, H. Kawaguchi
Pradimicin, a novel class of potent antifungal antibiotics
J. Antibiot. (Tokyo), 41 (1988), pp. 1701-1704, 10.7164/ANTIBIOTICS.41.1701
View in Scopus Google Scholar

[50] [50]
J.C. Sheehan, D. Mania, S. Nakamura, J.A. Stock, K. Maeda
The structure of telomycin
J. Am. Chem. Soc., 90 (1968), pp. 462-470, 10.1021/JA01004A043
View in Scopus Google Scholar

[51] [51]
A. Ammar, M.I. Abd El-Hamid, Y.M. Hashem, R.M.S. El-Malt, H.M. Mohamed
Mycoplasma bovis: taxonomy, characteristics, pathogenesis and antimicrobial resistance
Zagazig Vet. J., 49 (2021), pp. 444-461, 10.21608/ZVJZ.2021.103834.1160
Google Scholar

[52] [52]
A.M. Ammar, M.I. Abd El-Hamid, R.M.S. El-Malt, D.S. Azab, S. Albogami, M.M. Al-Sanea, W.E. Soliman, M.M. Ghoneim, M.M. Bendary
Molecular detection of fluoroquinolone resistance among multidrug-, extensively drug-, and pan-drug-resistant Campylobacter species in Egypt
Antibiotics, 10 (2021), p. 1342, 10.3390/ANTIBIOTICS10111342
View in Scopus Google Scholar

[53] [53]
A.M. Ammar, E.-S.Y. El-Naenaeey, R.M.S. El-Malt, A.A. El-Gedawy, E. Khalifa, S.S. Elnahriry, M.I. Abd El-Hamid
Prevalence, antimicrobial susceptibility, virulence and genotyping of Campylobacter jejuni with a special reference to the anti-virulence potential of eugenol and beta-resorcylic acid on some multi-drug resistant isolates in Egypt
Animals, 1 (2021), Article 10003, 10.3390/ani11010003
Google Scholar

[54] [54]
A.M. Ammar, E.-S.Y. El-Naenaeey, M.I.A. El-Hamid, A.A. El-Gedawy, R.M.S. El-Malt
Campylobacter as A major foodborne pathogen: a review of its characteristics, pathogenesis, antimicrobial resistance and control
J. Microbiol. Biotechnol. Food Sci., 10 (2021), pp. 609-619, 10.15414/JMBFS.2021.10.4.609-619
View in Scopus Google Scholar

[55] [55]
A. Ramazani, S. Moradi, R. Sorouri, S. Javani, M. Garshasbi
Screening for antibacterial activity of Streptomyces species isolated from Zanjan province, Iran
Int. J. Pharmaceut. Chem. Biol. Sci., 3 (2013), pp. 342-349
https://www.researchgate.net/profile/Ali-Ramazani-2/publication/282671200_Screening_for_antibacterial_activity_of_streptomyces_species_isolated_from_zanjan_province_Iran/links/5617ec2008ae6d1730846f4d/Screening-for-antibacterial-activity-of-streptomyces-s, Accessed 18th Jul 2024
Google Scholar

[56] [56]
M. Manimaran, J.V. Gopal, K. Kannabiran
Antibacterial activity of Streptomyces sp. VITMK1 isolated from mangrove soil of pichavaram, Tamil nadu, India
Proc. Natl. Acad. Sci. India B Biol. Sci., 87 (2017), pp. 499-506, 10.1007/S40011-015-0619-5/METRICS
View in Scopus Google Scholar

[57] [57]
K. Khadayat, D.D. Sherpa, K.P. Malla, S. Shrestha, N. Rana, B.P. Marasini, S. Khanal, B. Rayamajhee, B.R. Bhattarai, N. Parajuli
Molecular identification and antimicrobial potential of Streptomyces species from Nepalese soil
Internet J. Microbiol., 2020 (2020), Article 8817467, 10.1155/2020/8817467
View in Scopus Google Scholar

[58] [58]
R. Manikkam, G. Venugopal, B. Subramaniam, B. Ramasamy, V. Kumar
Bioactive potential of actinomycetes from less explored ecosystems against Mycobacterium tuberculosis and other nonmycobacterial pathogens
Int. Sch. Res. Notices, 2014 (2014), Article 812974, 10.1155/2014/812974
Google Scholar

[59] [59]
I. Charousova, J. Medo, E. Halenárová, S. Javoreková
Antimicrobial and enzymatic activity of actinomycetes isolated from soils of coastal islands
\"J. Adv. Pharm. Technol. Research\"\" (JAPTR)\", 8 (2017), p. 46, 10.4103/JAPTR.JAPTR_161_16
View in Scopus Google Scholar

[60] [60]
M.K. Mirzaei, A.S. Nilsson
Isolation of phages for phage therapy: a comparison of spot tests and efficiency of plating analyses for determination of host range and efficacy
PLoS One, 10 (2015), Article e0118557, 10.1371/JOURNAL.PONE.0118557
View in Scopus Google Scholar

[61] [61]
N. Lu, C. Kim, Z. Chen, Y. Wen, Q. Wei, Y. Qiu, S. Wang, Y. Song
Characterization and genome analysis of the temperate bacteriophage ϕSAJS1 from Streptomyces avermitilis
Virus Res., 265 (2019), pp. 34-42, 10.1016/J.VIRUSRES.2019.03.006
View PDF View article View in Scopus Google Scholar

[62] [62]
Y. Kizheva, M. Eftimova, R. Rangelov, N. Micheva, Z. Urshev, I. Rasheva, P. Hristova
Broad host range bacteriophages found in rhizosphere soil of a healthy tomato plant in Bulgaria
Heliyon, 7 (2021), Article e07084, 10.1016/j.heliyon.2021.e07084
View PDF View article View in Scopus Google Scholar

[63] [63]
J. Anne, L. Van Mellaert, B. Decock, J. Van Damme, A. Van Aerschot, P. Herdewijn, H. Eyssen
Further biological and molecular characterization of actinophage VWB
J. Gen. Microbiol., 136 (1990), pp. 1365-1372, 10.1099/00221287-136-7-1365/CITE/REFWORKS
View in Scopus Google Scholar

[64] [64]
E.W. Bumunang, T.A. McAllister, K. Stanford, H. Anany, Y.D. Niu, C.N. Ateba
Characterization of non-O157 STEC infecting bacteriophages isolated from cattle faeces in north-west South Africa
Microorganisms, 7 (2019), p. 615, 10.3390/MICROORGANISMS7120615
View in Scopus Google Scholar

[65] [65]
S. Kronheim, E. Solomon, L. Ho, M. Glossop, A.R. Davidson, K.L. Maxwell
Complete genomes and comparative analyses of Streptomyces phages that influence secondary metabolism and sporulation
Sci. Rep., 13 (2023), pp. 1-11, 10.1038/s41598-023-36938-z
Google Scholar

[66] [66]
P.R. Shetty, S.K. Buddana, V.B. Tatipamula, Y.V.V. Naga, J. Ahmad
Production of polypeptide antibiotic from Streptomyces parvulus and its antibacterial activity
Braz. J. Microbiol., 45 (2014), pp. 303-312, 10.1590/S1517-83822014005000022
View in Scopus Google Scholar

[67] [67]
C.W. Johnston, M.A. Skinnider, C.A. Dejong, P.N. Rees, G.M. Chen, C.G. Walker, S. French, E.D. Brown, J. Berdy, D.Y. Liu, N.A. Magarvey
Assembly and clustering of natural antibiotics guides target identification
Nat. Chem. Biol., 12 (2016), pp. 233-239, 10.1038/nchembio.2018
View in Scopus Google Scholar

[68] [68]
S. Wei, W. Zhang, Z. Ji
Structure and antibacterial activity of ambobactin, a new telomycin-like cyclic depsipeptide antibiotic produced by Streptomyces ambofaciens F3
Molecules, 20 (2015), pp. 16278-16289, 10.3390/MOLECULES200916278
View in Scopus Google Scholar

[69] [69]
C.W. Johnston, M.A. Skinnider, C.A. Dejong, P.N. Rees, G.M. Chen, C.G. Walker, S. French, E.D. Brown, J. Berdy, D.Y. Liu, N.A. Magarvey
Assembly and clustering of natural antibiotics guides target identification
Nat. Chem. Biol., 2 (12) (2016), pp. 233-239, 10.1038/nchembio.2018
View in Scopus Google Scholar